NMN adenylyltransferase raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-02-01 and is reviewed periodically as new material appears.
Nicotinamide mononucleotide, abbreviated NMN, is a nucleotide composed of nicotinamide, ribose, and phosphate. Its structure links nicotinamide to D-ribose 5-phosphate through a glycosidic bond, placing it in the pyridine nucleotide family. The compound exists in alpha and beta anomeric forms, and the beta form is the one used in NAD+ biosynthesis. NMN is not a protein or a hormone; it is a small water-soluble molecule that occurs in living cells as a metabolic intermediate.
Natural sources of NMN include mammals, plants, and microorganisms, where it functions as an intermediate in NAD+ salvage and biosynthesis pathways. In mammals, the enzyme nicotinamide phosphoribosyltransferase produces NMN from nicotinamide and phosphoribosyl pyrophosphate. NMN is then converted to NAD+ by nicotinamide mononucleotide adenylyltransferase. Some foods contain measurable NMN, but reported amounts vary widely by species, tissue, and analytical method. The extent to which dietary NMN contributes to cellular NAD+ pools remains an open research question.
Beyond its intracellular synthesis, NMN can be taken up from the extracellular environment, although the routes are still debated. Some evidence points to direct transport into cells through specific transporters, while other work suggests dephosphorylation to nicotinamide riboside followed by cellular uptake. Once inside, NMN can be converted to NAD+ by NMN adenylyltransferases; the relative contribution of these routes may differ by tissue, species, and experimental conditions. Researchers continue to investigate which mechanisms dominate in intact organisms and how they affect measured NAD+ levels. Direct measurement in tissues remains technically challenging because NMN can be rapidly metabolized during sample collection.
NMN occurs in many living systems, including bacteria, yeast, plants, and mammals. Dietary sources are present in foods such as edamame, avocado, broccoli, and various meats, but amounts vary widely and are generally lower than those used in research settings. Laboratory production often relies on enzymatic synthesis or chemical phosphorylation of nicotinamide riboside, and commercial material is typically supplied as a white to off-white powder. Because NMN is hygroscopic and sensitive to heat, moisture, and pH extremes, its handling requires care to preserve identity and purity. Aqueous preparation should be done with attention to pH and temperature to limit hydrolysis.
| Property | Value | Notes |
|---|---|---|
| Common name | Nicotinamide mononucleotide | Often abbreviated NMN |
| Chemical formula | C11H15N2O8P | Beta anomer form |
| Molecular mass | 334.22 g/mol | Calculated from formula |
| CAS Registry Number | 1094-61-7 | Beta-NMN |
| Appearance | White to off-white powder | Typical laboratory grade |
Research on NMN has expanded because NAD+ concentrations decline with age in some tissues and because NAD+ participates in energy metabolism, DNA repair, and signaling. Animal studies have reported changes in NAD+ levels after NMN administration, but human data are more limited and often focus on safety, pharmacokinetics, and biomarker changes. Questions remain about oral absorption, tissue distribution, and whether changes in blood NAD+ reflect changes inside specific organs. NMN is not an approved drug, and claims about its clinical effects should be distinguished from established biochemical findings.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide. Its structure combines a nicotinamide ring, a ribose sugar, and a phosphate group. The compound exists in cells as an intermediate in the production of nicotinamide adenine dinucleotide, a central redox cofactor. NMN is distinct from nicotinamide riboside, another related pyridine nucleotide, although the two compounds can converge in metabolic pathways. Its chemical formula is C11H15N2O8P, and it carries a net negative charge at physiological pH.
In the salvage pathway, NMN is generated from nicotinamide and 5-phosphoribosyl-1-pyrophosphate by the enzyme nicotinamide phosphoribosyltransferase. A second route produces NMN from nicotinamide riboside through phosphorylation by nicotinamide riboside kinases. NMN is then converted to NAD+ by nicotinamide mononucleotide adenylyltransferases, often called NMNAT enzymes. This stepwise route allows cells to recycle nicotinamide and maintain NAD+ levels under changing metabolic conditions. The relative contribution of each route varies by tissue, species, and physiological state, and it remains an active area of research.
Research on NMN has focused on aging, metabolic regulation, exercise capacity, and insulin sensitivity, but findings are preliminary. Many human trials are small, short in duration, and use different endpoints, which complicates comparison across studies. No national regulator has approved NMN as a therapeutic drug for any indication. In some countries it is sold as a supplement or research chemical, while other jurisdictions have questioned its status under food or supplement laws. Claims about extending human lifespan or reversing aging are not supported by established clinical evidence.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide found in the cells of many organisms, including bacteria, plants, and mammals. Its structure consists of a nicotinamide ring attached to a ribose-phosphate group. NMN functions as an intermediate in the NAD+ salvage pathway, a recycling route that regenerates nicotinamide adenine dinucleotide. The enzyme nicotinamide phosphoribosyltransferase produces NMN from nicotinamide and phosphoribosyl pyrophosphate. A second enzyme, NMN adenylyltransferase, then converts NMN into NAD+.
The MEROPS online database for peptidases and their inhibitors: I04.018 Archived 2019-10-16 at the Wayback Machine Antithrombin+III at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Human SERPINC1 genome location and SERPINC1 gene details page in the UCSC Genome Browser.
== Media == The Cherokee Nation publishes the Cherokee Phoenix, currently a monthly newspaper. The paper has operated nearly continuously since 1828, publishing editions in both English and the Cherokee syllabary (also known as the Sequoyah syllabary). It holds historical significance as both the first newspaper to be published by Native Americans in the United States and the first to be published in a Native American language.
== Transportation systems == Link (Rochester), an under-construction BRT line in Rochester, Minnesota, US Link (Saskatoon), an under-construction BRT in Canada Link light rail, operated by Sound Transit, in the region of Seattle, Washington, US Terminal Link, Toronto Airport, Canada San Leandro LINKS, a bus service, California, US Link bus services, a service in Auckland, New Zealand
== Mathematics and logic == Contraction (operator theory), in operator theory, state of a bounded operator between normed vector spaces after suitable scaling Contraction hierarchies, in applied mathematics, a technique to speed up shortest-path routing Contraction mapping, a type of function on a metric space Edge contraction or vertex contraction, graph operations used in graph theory Tensor contraction, an operation on one or more tensors that arises from the natural pairing of a finite-dimensional vector space and its dual Interior product, a tensor contraction specifically of a differential form with a vector field Left contraction and right contraction of multivectors in a geometric algebra, extensions of the inner product One of the rules of conditional independence, in probability Contraction (logic), a structural rule in proof theory
Sources: en.wikipedia.org
A membrane ligand (protein, oligosaccharide, lipid) and a membrane protein of two adjacent cells interact. A communicating gap junction links the intracellular compartments of two adjacent cells, allowing transit of relatively small molecules. An extracellular matrix glycoprotein and a membrane protein interact. Additionally, in unicellular organisms such as bacteria, juxtacrine signaling means interactions by membrane contact. Juxtacrine signaling has been observed for some growth factors, cytokine and chemokine cellular signals, playing an important role in the immune response. Juxtacrine signalling via direct membrane contacts is also present between neuronal cell bodies and motile processes of microglia both during development, and in the adult brain.
== History == Because of its central geographic position within the Yugoslav federation, post-war Bosnia was strategically selected as a base for the development of the military defense industry. This contributed to a large concentration of arms and military personnel in Bosnia; a significant factor in the war that followed the break-up of Yugoslavia in the 1990s. However, Bosnia's existence within Yugoslavia, for the large part, was peaceful and prosperous. Being one of the poorer republics in the early 1950s it quickly recovered economically, taking advantage of its extensive natural resources to stimulate industrial development. The Yugoslavian communist doctrine of "brotherhood and unity" particularly suited Bosnia's diverse and multi-ethnic society that, because of such an imposed system of tolerance, thrived culturally and socially. The improvements to cultural tolerance throughout Bosnia and Herzegovina culminated with the selection of Sarajevo to host the 1984 Winter Olympics.
Pyrite.Virtual Museum of Mineralogy. Universidad de Zaragoza, Spain Educational article about the famous pyrite crystals from the Navajun Mine How Minerals Form and Change "Pyrite oxidation under room conditions". Poliakoff, Martyn (2009). "Fool's Gold". The Periodic Table of Videos. University of Nottingham.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
== Interactions == Pappalysin-1 has been shown to interact with major basic protein. Studies conducted at the Royal London Hospital in the United Kingdom, have shown that a marker of Down syndrome may be expressed during the first trimester and second trimester of a pregnancy term. Concentrations of the Pregnancy-Associated Plasma Protein (PAPPA) gene as well as other markers can help screen for Down syndrome in the beginning stages of a woman's gestational period.
Sources: en.wikipedia.org
NMN stands for nicotinamide mononucleotide. It is a naturally occurring nucleotide and an intermediate in NAD+ biosynthesis.
No. NMN is a precursor that can be converted to NAD+ in cells. NAD+ is the larger dinucleotide that participates in many redox reactions.
Small amounts of NMN have been reported in several foods, including certain vegetables and fruits. The measured levels vary, and the significance of dietary intake is not fully established.
NMN is nicotinamide mononucleotide, a nucleotide intermediate in NAD+ biosynthesis. It consists of nicotinamide, ribose, and phosphate groups.